|
ATCC
293t cells ![]() 293t Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/293t cells/product/ATCC Average 99 stars, based on 1 article reviews
293t cells - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
ATCC
isoflurane immortalized human renal proximal tubule hk 2 cells ![]() Isoflurane Immortalized Human Renal Proximal Tubule Hk 2 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/isoflurane immortalized human renal proximal tubule hk 2 cells/product/ATCC Average 99 stars, based on 1 article reviews
isoflurane immortalized human renal proximal tubule hk 2 cells - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
ATCC
embryonic kidney cell line 293t ![]() Embryonic Kidney Cell Line 293t, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/embryonic kidney cell line 293t/product/ATCC Average 99 stars, based on 1 article reviews
embryonic kidney cell line 293t - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
ATCC
african green monkey kidney derived cos 7 cells ![]() African Green Monkey Kidney Derived Cos 7 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/african green monkey kidney derived cos 7 cells/product/ATCC Average 99 stars, based on 1 article reviews
african green monkey kidney derived cos 7 cells - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
ATCC
human embryonic kidney line hek293t atcc crl 2316 oligonucleotides 5ʹ ha donor l 5ʹ gtcacacttggggtcctcag 3ʹ ![]() Human Embryonic Kidney Line Hek293t Atcc Crl 2316 Oligonucleotides 5ʹ Ha Donor L 5ʹ Gtcacacttggggtcctcag 3ʹ, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human embryonic kidney line hek293t atcc crl 2316 oligonucleotides 5ʹ ha donor l 5ʹ gtcacacttggggtcctcag 3ʹ/product/ATCC Average 95 stars, based on 1 article reviews
human embryonic kidney line hek293t atcc crl 2316 oligonucleotides 5ʹ ha donor l 5ʹ gtcacacttggggtcctcag 3ʹ - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
|
ATCC
mouse kidney collecting duct cell line m1 ![]() Mouse Kidney Collecting Duct Cell Line M1, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse kidney collecting duct cell line m1/product/ATCC Average 97 stars, based on 1 article reviews
mouse kidney collecting duct cell line m1 - by Bioz Stars,
2026-06
97/100 stars
|
Buy from Supplier |
|
Aviva Systems
full length adiponectin ![]() Full Length Adiponectin, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/full length adiponectin/product/Aviva Systems Average 90 stars, based on 1 article reviews
full length adiponectin - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
DSMZ
cell lines hek 293t 293tsa1609neo dsmz acc 635 hek293t cav1 2 auxiliary subunits boehringer ingelheim ortner ![]() Cell Lines Hek 293t 293tsa1609neo Dsmz Acc 635 Hek293t Cav1 2 Auxiliary Subunits Boehringer Ingelheim Ortner, supplied by DSMZ, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cell lines hek 293t 293tsa1609neo dsmz acc 635 hek293t cav1 2 auxiliary subunits boehringer ingelheim ortner/product/DSMZ Average 96 stars, based on 1 article reviews
cell lines hek 293t 293tsa1609neo dsmz acc 635 hek293t cav1 2 auxiliary subunits boehringer ingelheim ortner - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
ATCC
renca ![]() Renca, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/renca/product/ATCC Average 96 stars, based on 1 article reviews
renca - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
ATCC
hek293t ![]() Hek293t, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hek293t/product/ATCC Average 96 stars, based on 1 article reviews
hek293t - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Proteintech
anti nox4 ![]() Anti Nox4, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti nox4/product/Proteintech Average 96 stars, based on 1 article reviews
anti nox4 - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Novus Biologicals
monoclonal anti mouse tlr6 antibody monoclonal anti mouse tlr9 antibody ![]() Monoclonal Anti Mouse Tlr6 Antibody Monoclonal Anti Mouse Tlr9 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/monoclonal anti mouse tlr6 antibody monoclonal anti mouse tlr9 antibody/product/Novus Biologicals Average 94 stars, based on 1 article reviews
monoclonal anti mouse tlr6 antibody monoclonal anti mouse tlr9 antibody - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Acta Neuropathologica Communications
Article Title: Phenotypic characterization with somatic genome editing and gene transfer reveals the diverse oncogenicity of ependymoma fusion genes
doi: 10.1186/s40478-020-01080-8
Figure Lengend Snippet: CRISPR/Cas9-mediated gene rearrangement induced endogenous RELA FUS1 in human cultured cells. a Experimental strategy for the CRISPR/Cas9-mediated gene rearrangement to induce endogenous RELA FUS1 in 293T cells. Blue and red boxes represent exons of the C11orf95 and RELA genes, respectively. Black arrowheads indicate cleavage sites by the sgRNAs. Red arrows indicate PCR primer pairs for the fusion-junction detection. b sgRNA combination for the CRISPR/Cas9-mediated gene rearrangement in 293T cells. c RT-PCR detection of RELA FUS1 transcript in 293T cells. RNA was extracted from 293T cells that were transiently transfected with the sgRNA combination-1, 2 or mock vectors (left panel) The RNA was then subjected to RT-PCR analyses for C11orf95-RELA fusion junction (left-top) and intact RELA detection (left-bottom panel). The electropherograms of the Set-1 and 2 PCR products are shown in right-top and right-bottom panels, respectively. NT, non-treated parental 293T cells. d Western blot analysis for RELA FUS1 detection in the gene-edited 293T cells. The set-1 and set-2 sgRNAs were transiently transfected into 293T cells. Cell lysates were subjected to immunoblot blot analysis with the indicated antibodies. Upper (red) and lower (black asterisk) bands in the RELA antibody detection indicate RELA FUS1 and endogenous RELA protein, respectively. Cell lysate extracted from pTomo-RELA FUS1 -induced brain tumor tissue serves as a positive control for RELA FUS1 protein expression
Article Snippet:
Techniques: CRISPR, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Transfection, Western Blot, Positive Control, Expressing
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: A and B. IL-11 mRNA measured with reverse transcription polymerase chain reaction (RTPCR) in HK-2 cells treated with 0-2.5% isoflurane for 6 h (A. N = 6) or 2.5% isoflurane for 0-6 h (B, N = 6). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression was quantified to normalize lane loading. Data are presented as means ± SD. * P < 0.05 vs. IL-11 mRNA measured after 0% isoflurane-treatment (A) or at 0 h (B). C. Isoflurane increases IL-11 protein (pg/ml) in cell culture media from HK-2 cells (N = 6). HK-2 cells were treated with 2.5% isoflurane or with carrier gas for 6 h or 16 h. * P < 0.05 vs. carrier gas treated group.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing, Cell Culture
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: A. IL-11 messenger ribonucleic acid (mRNA) (detected with reverse transcription polymerase chain reaction (RTPCR)) expression in HK-2 cells treated with 2.5% isoflurane for 6 h (N = 6). Representative images (top) and band intensity quantifications (bottom) expressed as fold increases in IL-11 expression over carrier gas plus immunoglobulin G (IgG) isotype antibody treated controls. B. IL-11 protein (detected with enzyme-linked immunosorbent assay (ELISA)) expression in HK-2 cells treated with 2.5% isoflurane for 6 h (N = 6). * P < 0.05 vs. carrier gas group treated with IgG isotype antibody. # P < 0.05 vs. isoflurane group treated with IgG isotype antibody. Error bars represent 1 SD. TGF-β1 antibody (10 μg/ml) prevents isoflurane-mediated induction of IL-11 mRNA and protein expression in human proximal tubule cells.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing, Enzyme-linked Immunosorbent Assay
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: IL-11 mRNA (reverse transcription polymerase chain reaction (RTPCR)) expression in primary culture of mouse proximal tubule cells treated with 2.5% isoflurane for 6 h (N = 4). Representative images (top) and band intensity quantifications (bottom) expressed as fold increases in IL-11 expression over carrier gas and immunoglobulin G (IgG) isotype antibody treated controls. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression was also quantified to normalize lane loading. * P < 0.05 vs. carrier gas group treated with IgG isotype antibody. # P < 0.05 vs. isoflurane group treated with IgG isotype antibody. Error bars represent 1 SD. TGF-β1 antibody (10 μg/ml) prevents isoflurane-mediated induction of IL-11 mRNA and protein expression in mouse proximal tubule cells.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: Naïve IL-11 wild-type (WT) mice were exposed to pentobarbital (PB) or 1.2% isoflurane (ISO) for 4 h. A. Representative bands for IL-11 mRNA (reverse transcription polymerase chain reaction (RTPCR)) expression in mouse kidney (N = 4). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal loading control. B. Kidney lysate IL-11 protein (detected by enzyme-linked immunosorbent assay (ELISA)) in IL-11 naïve WT mice exposed to pentobarbital (PB) or 1.2% isoflurane (ISO) for 4 h (N = 4). To neutralize TGF-β1 in vivo, some IL-11 WT mice were injected with 5 mg/kg monoclonal anti-TGF-β1 (MAB240) antibody intravenous injection. TGF-β1 neutralization prevented the induction of IL-11 after isoflurane anesthesia. * P < 0.05 vs. pentobarbital anesthetized mice treated with immunoglobulin G (IgG) isotype antibody. # P < 0.05 vs. isoflurane anesthetized mice treated with IgG isotype antibody. Error bars represent 1 SD. Isoflurane anesthesia significantly increased kidney IL-11 mRNA and protein expression in mice.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing, Control, Enzyme-linked Immunosorbent Assay, In Vivo, Injection, Neutralization
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: A. IL-11 immunohistochemistry (400× shown, N = 4) in kidneys from IL-11 receptor wild type (IL-11R WT) mice anesthetized with pentobarbital or with 1.2% isoflurane for 4 h. IL-11 staining was darker in kidneys of mice anesthetized with isoflurane. TGF-β1 neutralizing antibody attenuated isoflurane-mediated increase in IL-11 immunoreactivity. Finally, IL-11 staining was not visible in kidneys from mice stained with negative isotype control antibodies (representative of four experiments). B. Quantifications of renal tubular IL-11 staining in mice anesthetized with pentobarbital or with 1.2% isoflurane for 4 h. Kidney IL-11 immunoreactivity significantly increased in mice anesthetized with isoflurane and attenuated with TGF-β1 neutralizing antibody. # P < 0.05 vs. isoflurane anesthetized mice treated with immunoglobulin G (IgG) isotype antibody. * P < 0.05 vs. pentobarbital-anesthetized mice. Error bars represent 1 SD.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Immunohistochemistry, Staining, Control
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: Plasma creatinine levels from IL-11 wild-type (WT) or IL-11 deficient (KO) mice subjected to 30 min renal ischemia and 24 h reperfusion (N = 4-6 per group). After renal ischemia reperfusion (RIR), mice were further anesthetized with 1.2% isoflurane (ISO) or with equi-anesthetic dose of pentobarbital (PB). Some IL-11 receptor (IL-11R) WT mice were pretreated with an IL-11 neutralizing antibody (1 mg/kg, intravenous injection) 20 min before reperfusion or sham-operation. Isoflurane postconditioning significantly reduced plasma creatinine after RIR injury in IL-11R WT mice. However, IL-11R deficiency or IL-11 neutralizing antibody prevented the renal protective effects of isoflurane post-conditioning. * P < 0.05 vs. respective sham-operated mice. # P < 0.05 vs. pentobarbital anesthetized mice subjected to RIR. Data are from 6 mice per group and represented as mean ± SD.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Clinical Proteomics, Injection
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: A. Representative photomicrographs of five to six experiments for hematoxylin and eosin staining (magnification 200×) of kidneys of IL-11 receptor wild-type (IL-11R WT) mice, IL-11 receptor deficient (IL-11R KO) mice and IL-11R WT mice pretreated with IL-11 neutralizing antibody and subjected to 30 min renal ischemia and 24-h reperfusion (I/R). B. Summary of Jablonski scale renal injury scores (N = 4, graded from hematoxylin and eosin staining, scale 0-4) for mice subjected to renal I/R. * P < 0.05 vs. pentobarbital-anesthetized IL-11R WT mice subjected to renal I/R. Error bars represent 1 SD. IL-11R WT mice anesthetized with pentobarbital after renal ischemia showed severe renal tubular necrosis. Isoflurane post-conditioning significantly attenuated renal tubular necrosis and renal injury scores after renal IR. IL-11R deficiency (IL-11R KO) or IL-11 neutralization prevented renal protection with isoflurane postconditioning in mice.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Staining, Neutralization
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: A. Representative photomicrographs of four to six experiments for immunohistochemistry (brown staining) for neutrophil infiltration (200×) from kidneys IL-11 receptor wild-type (IL-11R WT) mice, IL-11 receptor deficient (IL-11R KO) mice and IL-11R WT mice pretreated with IL-11 neutralizing antibody and subjected to 30 min. renal ischemia and 24-h reperfusion. B. Quantifications of infiltrated neutrophils per 200× field in the kidneys of mice after renal ischemia reperfusion (RIR). * P < 0.05 vs. vehicle-treated pentobarbital anesthetized mice subjected to RIR. Error bars represent 1 SD. IL-11R WT mice anesthetized with pentobarbital after renal ischemia showed heavy neutrophil infiltration. Isoflurane postconditioning significantly attenuated renal tubular neutrophil infiltration after RIR. IL-11 deficiency (IL-11R KO) or IL-11 neutralization attenuated these reductions in renal neutrophil infiltration with isoflurane post-conditioning in mice.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Immunohistochemistry, Staining, Neutralization
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: A. Representative photomicrographs of four to six experiments for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining (representing apoptotic nuclei, magnification 100×) from kidneys IL-11 receptor wild-type (IL-11R WT) mice, IL-11 receptor deficient (IL-11R KO [knockout]) mice and IL-11R WT mice pretreated with IL-11 neutralizing antibody and subjected to 30 min renal ischemia and 24-h reperfusion. B. Quantifications of apoptotic cells per 100× field in the kidneys of mice after renal ischemia reperfusion (RIR). * P < 0.05 vs. vehicle-treated pentobarbital anesthetized mice subjected to RIR. Error bars represent 1 SD. IL-11R WT mice anesthetized with pentobarbital after renal ischemia showed numerous TUNEL positive cells. Isoflurane postconditioning significantly attenuated renal tubular apoptosis after RIR. IL-11 deficiency (IL-11R KO) or IL-11 neutralization attenuated these reductions in renal tubular apoptosis with isoflurane postconditioning in mice.
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: TUNEL Assay, Staining, Knock-Out, Neutralization
Journal: Anesthesiology
Article Title: Critical Role of Interleukin-11 in Isoflurane-mediated Protection against Ischemic Acute Kidney Injury in Mice
doi: 10.1097/ALN.0b013e3182a950da
Figure Lengend Snippet: Collectively, our data suggest that isoflurane anesthesia increases interleukin (IL)-11 messenger RNA (mRNA) and protein synthesis via TGF-β1 signaling. We propose that IL-11 synthesized then subsequently activates IL-11R in neighboring renal tubules, or endothelial cells to induce cytoprotective signaling. Since previous studies have shown that IL-11 reduces the activity of a well-known proinflammatory transcription factor NF-kB49;50, it is highly possible that IL-11 generated with isoflurane treatment may also attenuate NF-kB activity to protect against renal inflammation and injury after acute kidney injury. SMADs are intracellular proteins that transduce extracellular signals from TGF-β1 to the nucleus to initiate downstream gene transcription. Hypothetical pathways (e.g., NF-kB inhibition) leading to cytoprotection are shown in dashed lines. We previous showed that IL-11 produces renal protection by direct induction of sphingosine kinase-1 via nuclear translocation of HIF-1α.14
Article Snippet: Human and mouse proximal tubule cell culture and exposure to
Techniques: Synthesized, Activity Assay, Generated, Inhibition, Translocation Assay
Journal: PLoS Pathogens
Article Title: Interactions of Prototype Foamy Virus Capsids with Host Cell Polo-Like Kinases Are Important for Efficient Viral DNA Integration
doi: 10.1371/journal.ppat.1005860
Figure Lengend Snippet: eGFP-PLK-expressing constructs alone (left panels) or a combination of eGFP or eGFP-PLK and Gag-mCherry encoding expression constructs (right panels) were transfected into 293T cells, as indicated above each panel of images. Forty-eight hours post-transfection, protein localization patterns were examined in fixed cells by confocal laser scanning microscopy (CLSM). Channels of the individual fluorescence micrographs are indicated on top, and the PLK variant used is indicated on the left. White arrowheads indicate fluorescent PLK foci presumed to be centrosomes. Data are representative of n = 5 independent experiments. (A) Localization patterns of eGFP-tagged PLK proteins (detected in eGFP-PLK channel) in mitotic cells transfected with the corresponding constructs. (B) Localization patterns of eGFP-tagged PLK and mCherry-tagged Gag proteins detected in corresponding channels (Gag variant used labeled either as wt-mCh or T225A-mCh) in mitotic cells. (C) Localization of eGFP and wt Gag-mCherry in mitotic cells. (D) Localization patterns of eGFP-tagged PLK proteins (detected in eGFP-PLK channel) in interphase cells transfected with the corresponding constructs. (E) Localization patterns of eGFP-tagged PLK and mCherry-tagged Gag proteins detected in corresponding channels (Gag variant used labeled either as wt-mCh or T225A-mCh) in interphase cells. Scale bar: 10 μm.
Article Snippet: The human
Techniques: Expressing, Construct, Transfection, Confocal Laser Scanning Microscopy, Fluorescence, Variant Assay, Labeling
Journal: PLoS Pathogens
Article Title: Interactions of Prototype Foamy Virus Capsids with Host Cell Polo-Like Kinases Are Important for Efficient Viral DNA Integration
doi: 10.1371/journal.ppat.1005860
Figure Lengend Snippet: PFV virions were produced by transient transfection of the four-component PFV vector system, containing the pcoPG4 variants denoted above each of the blots, into 293T cells. Viral particles were pelleted from cell-free tissue culture supernatants by ultracentrifugation through 20% sucrose and equal amounts of particle lysates separated by SDS-PAGE were blotted to nitrocellulose membranes. The phosphorylation status of the particle-associated Gag variants was determined by the corresponding antibodies specific for different phosphorylated amino acid motives as indicated. Data are representative of n = 4 independent experiments. (A) Schematic illustration of PFV Gag protein organization with highlighted putative T-P motifs and surrounding amino acids recognized when phosphorylated at the threonine residue by either the α-pT-P (orange letters) or α-Gag S-pT-P (blue letters) phosphopeptide-specific antibody. Solid vertical arrow: primary Gag processing site; dashed vertical arrows: secondary Gag processing sites; (B) Detection of the phosphorylated Thr-Pro (pT-P) motives in PFV Gag wt, iSTP and pmSTP virus particles (α-pT-P antiserum) and comparison with the total Gag content in the particle lysates (α-Gag). (C) Comparison of the pT-P phosphorylation status in the wt and T225A PFV particles in the absence (-) or presence (+) of the Lambda Phosphatase (λP) pretreatment of viral proteins. (D) Comparison of the PFV Gag-associated S-T-P motif phosphorylation status (α-Gag S-pT-P; detected with the corresponding PFV Gag-specific antibody) in virus preparations containing either the wt or the T225A Gag variant in the absence (-) or presence (+) of the λP pretreatment.
Article Snippet: The human
Techniques: Produced, Transfection, Plasmid Preparation, SDS Page, Phospho-proteomics, Residue, Virus, Comparison, Variant Assay
Journal: PLoS Pathogens
Article Title: Interactions of Prototype Foamy Virus Capsids with Host Cell Polo-Like Kinases Are Important for Efficient Viral DNA Integration
doi: 10.1371/journal.ppat.1005860
Figure Lengend Snippet: (A) PFV virions were produced by transient transfection of 293T cells with the four-component PFV vector system, containing either the wt Gag or one of the denoted iSTP- and pmSTP Gag variants. Titers of harvested viruses were determined by flow cytometry analysis of infected HT1080 target cells three days post-infection. The mean values and standard deviation for each supernatant were calculated from samples of cells infected with serial virus dilutions as described in Material and Methods. The values obtained using wt PFV Gag expression plasmids were arbitrarily set to 100%. Relative means and standard deviations normalized for Gag content (except mock) from independent experiments (n = 4–9) are shown. Differences between means of wt virus and the individual mutants were analyzed by Welch’s t test (**, p<0.01). Absolute titers of wt supernatants ranged between 1.2 x 10 6 and 1.2 x 10 7 eGFP ffu/ml. (B) Replication-competent PFV virions were produced by transient transfection of proviral expression vectors, containing either the wt Gag or one of the denoted iSTP- and pmSTP Gag variants into 293T cells. Viruses were harvested two days post-transfection and used to infect HT1080 PLNE target cells. Titers were determined by flow cytometry analysis one day post-infection. The values obtained using wt PFV Gag expression plasmids were arbitrarily set to 100%. Relative means and standard deviations normalized for Gag content (except mock) from independent experiments (n = 3–8) are shown. Differences between means of wt virus and the individual mutants were analyzed by Welch’s t test (**, p<0.01). Absolute titers of wt supernatants ranged between 1.7 x 10 4 and 7 x 10 4 eGFP ffu/ml. (C) Titers of iSTP- and pmSTP mutant PFV particles relative to wt over multiple rounds of target cell infection. Viruses were produced and harvested as described in panel B and Gag content normalized amounts of viral supernatants were used to infect HT1080 PLNE in serial dilutions. At different time points post-infection (as indicated on the x-axis) cells were harvested for flow cytometry analysis to determine viral titers. The values obtained using wt PFV supernatants at each time point were arbitrarily set to 100%. Relative means and standard deviations from two independent experiments are shown.
Article Snippet: The human
Techniques: Produced, Transfection, Plasmid Preparation, Flow Cytometry, Infection, Standard Deviation, Virus, Expressing, Mutagenesis
Journal: PLoS Pathogens
Article Title: Interactions of Prototype Foamy Virus Capsids with Host Cell Polo-Like Kinases Are Important for Efficient Viral DNA Integration
doi: 10.1371/journal.ppat.1005860
Figure Lengend Snippet: Replication-competent PFV virions were produced by transient transfection of proviral expression constructs, containing either the wt Gag (wt) or one of the denoted iSTP- (S224A, T225A, P226A) or pmSTP (T225E) Gag variants into 293T cells. As controls, constructs containing wt Gag in combination with Pol with enzymatically inactive reverse transcriptase (iRT) or inactive integrase (iIN) domain, as well as constructs harboring translationally inactivated ORFs for Gag and Pol (ΔGag/Pol) or Env (ΔEnv) were used. The mock control (mock) included cells transfected with pUC19 alone. (A) Representative Western blot analysis of viral particles (virus) purified from 293T cell culture supernatant by ultracentrifugation through 20% sucrose and 293T cell lysates (cell). PFV proteins were detected using polyclonal antibodies specific for PFV Gag (α-Gag) or PFV Env LP (α-LP), a mixture of hybridoma supernatants specific for PFV Pol PR/RT and IN (α-PR/RT + α-IN), or a commercial monoclonal antibody specific for GAPDH (α-GAPDH). Serial dilutions of the wt samples (wt; lanes 6–9) were quantified to determine their relative protein contents compared to other samples. The identity of the individual proteins detected is indicated on the right. (B) Viral particle release was determined by quantitative Western blot analysis of viral particle lysates. Mean values and standard deviations (n = 3) are shown as relative values compared to the wt control and normalized for cellular expression levels. (C) Quantification of PFV vgRNA in virus producing cells (vgRNA cell) and released particles (vgRNA virus) and particle-associated vgDNA (vgDNA virus). Mean values and standard deviation (n = 3–8) are shown as relative values compared to the wt control. Cellular values were normalized to GAPDH levels, viral particle values were normalized for Gag content.
Article Snippet: The human
Techniques: Produced, Transfection, Expressing, Construct, Reverse Transcription, Control, Western Blot, Virus, Purification, Cell Culture, Standard Deviation
Journal: PLoS Pathogens
Article Title: Interactions of Prototype Foamy Virus Capsids with Host Cell Polo-Like Kinases Are Important for Efficient Viral DNA Integration
doi: 10.1371/journal.ppat.1005860
Figure Lengend Snippet: Replication-deficient PFV supernatants were harvested after transient transfection of the PFV four-component vector system, containing the eGFP-tagged Gag p68 wt (wt) or T225A (T225A) variants in combination with wt (wt) or fusion-incompetent Env (iFuse) into 293T cells. HT1080 cells were synchronously infected with undiluted (undil.) and ten-fold diluted (1:10) PFV supernatants and eGFP MFI values were measured by flow cytometry at indicated time points until 24 h post-transduction. Representative data shown are from one out of three independent experiments.
Article Snippet: The human
Techniques: Transfection, Plasmid Preparation, Infection, Flow Cytometry, Transduction
Journal: The Journal of Biological Chemistry
Article Title: FXYD5 Protein Has a Pro-inflammatory Role in Epithelial Cells
doi: 10.1074/jbc.M115.699041
Figure Lengend Snippet: FXYD5 increases LPS-induced CCL2 secretion in M1 cells. Wild type, M1+FXYD5, and FXYD4 silenced M1 cells were treated with either 100 ng/ml LPS or diluent. A, medium was removed 24 h later and assayed for CCL2 as described under “Experimental Procedures.” Means ± S.E. of at least three independent experiments are depicted. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ****, p < 0.0001, ns, non-significant. B, cells were lysed, total RNA extracted, and assayed for the abundance of CCL2 and GAPDH mRNA by RT-PCR as described under “Experimental Procedures.” Data are represented by arbitrary units normalized to GAPDH. Means ± S.E. of at least three independent experiments are depicted. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ***, p < 0.001. C, M1+FXYD5 cells were incubated with LPS with the indicated concentration for 24 h. CCL2 secretion was quantified as described above. Means ± S.E. of at least three independent experiments are depicted. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ****, p < 0.0001.
Article Snippet: Expression and Silencing of FXYD5 in Cultured Cells The
Techniques: Reverse Transcription Polymerase Chain Reaction, Incubation, Concentration Assay
Journal: The Journal of Biological Chemistry
Article Title: FXYD5 Protein Has a Pro-inflammatory Role in Epithelial Cells
doi: 10.1074/jbc.M115.699041
Figure Lengend Snippet: LPS-FITC binding to M1 cells. A, M1 WT and M1+FXYD5 cells were incubated for 30 min with FITC-LPS. Non-fluorescent LPS was added and competitive kinetics were observed by fluorescent signal decay under confocal microscopy (×20 magnification). Representative images of 0 min and 30 min time points are depicted (left panel). Scale bar, 10 μm. Total fluorescence of each image was calculated and plotted (bottom). Data points are means ± S.E. of 4 fields for each cell type. B, M1 WT and M1+FXYD5 cells were lysed, total RNA extracted, and assayed for the abundance of TLR4 mRNA by RT-PCR as described under “Experimental Procedures.” Data represented by arbitrary units normalized to GAPDH. Means ± S.E. of three experiments are depicted.
Article Snippet: Expression and Silencing of FXYD5 in Cultured Cells The
Techniques: Binding Assay, Incubation, Confocal Microscopy, Fluorescence, Reverse Transcription Polymerase Chain Reaction
Journal: The Journal of Biological Chemistry
Article Title: FXYD5 Protein Has a Pro-inflammatory Role in Epithelial Cells
doi: 10.1074/jbc.M115.699041
Figure Lengend Snippet: LPS-induced CCL2 secretion is mediated by NF-κB. A, confluent monolayers of M1+FXYD5 cells received either 100 nm of the indicated inhibitor or diluent. 30-min later the cultures received 100 ng/ml LPS and were incubated for 24 h. CCL2 secretion was analyzed in the culture medium. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ****, p < 0.0001. B, M1 and M1+FXYD5 cells were transfected with NF-κB-LUC and Renilla plasmids. After 24 h the cells were treated with 100 ng/ml LPS for 30 min at 37 °C. Luciferase activity was normalized to Renilla expression. Means ± S.E. of at least three independent experiments are depicted.
Article Snippet: Expression and Silencing of FXYD5 in Cultured Cells The
Techniques: Incubation, Transfection, Luciferase, Activity Assay, Expressing
Journal: The Journal of Biological Chemistry
Article Title: FXYD5 Protein Has a Pro-inflammatory Role in Epithelial Cells
doi: 10.1074/jbc.M115.699041
Figure Lengend Snippet: FXYD5-dependent CCL2 secretion is a result of late gene activation. WT M1 and M1+FXYD5 cells received 100 ng/ml LPS for the indicated periods of time. A, cells were lysed and total RNA was isolated and assayed for the abundance of CCL2 mRNA by RT-PCR. Data are represented by arbitrary units normalized to GAPDH. B, medium was collected and assayed for CCL2 as described under “Experimental Procedures.” Means ± S.E. of three experiments are depicted.
Article Snippet: Expression and Silencing of FXYD5 in Cultured Cells The
Techniques: Activation Assay, Isolation, Reverse Transcription Polymerase Chain Reaction
Journal: The Journal of Biological Chemistry
Article Title: FXYD5 Protein Has a Pro-inflammatory Role in Epithelial Cells
doi: 10.1074/jbc.M115.699041
Figure Lengend Snippet: LPS-induced TNFα stimulates CCL2 only in M1+FXYD5 cells. A, WT M1 and M1+FXYD5 cells received 100 ng/ml LPS for the indicated periods of time. Cells were lysed, and total RNA was isolated and assayed for the abundance of TNFα mRNA by RT-PCR. Data are represented by arbitrary units normalized to GAPDH. B, following 4 h of LPS stimulation, medium was collected and concentrated. Medium samples from LPS stimulated and non-stimulated cells were electrophoretically resolved, and TNFα secretion was analyzed with anti TNFα (1:1000) by Western blotting. C, wild type (WT) M1 and M1+FXYD5 cells were incubated for 24 h with the indicated concentrations of TNFα, and the CCL2 concentration in the medium was determined. Values are means ± S.E. of three independent experiments. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ***, p < 0.001.
Article Snippet: Expression and Silencing of FXYD5 in Cultured Cells The
Techniques: Isolation, Reverse Transcription Polymerase Chain Reaction, Western Blot, Incubation, Concentration Assay
Journal: The Journal of Biological Chemistry
Article Title: FXYD5 Protein Has a Pro-inflammatory Role in Epithelial Cells
doi: 10.1074/jbc.M115.699041
Figure Lengend Snippet: FXYD5 promotes plasma membrane expression of TNFR1. A, M1 and M1+FXYD5 were surface labeled with biotin, and total and surface-biotinylated proteins were extracted as described under “Experimental Procedures.” Western blots were analyzed with TNFR1-specific antibody. Tubulin and α1 subunit of Na,K-ATPase (α1/NaK) are shown as the loading controls for the total and surface expressed proteins, respectively. Two independent protein preparations from WT and M1+FXYD5 cells are depicted. B, RT-PCR was performed to measure TNFR1 mRNA abundance. Data are represented by arbitrary units normalized to GAPDH. C, CCL2 secretion following treatment with TNFR1 blocking antibody. Prior to LPS treatment, WT M1 and M1+FXYD5 cells were incubated for 1 h with 10 μg/ml TNFR1 blocking antibody or diluent. Medium was removed, and 0.5 ml of fresh medium was added ± 100 ng/ml LPS and incubated for 8 h. Medium was removed, and aliquots were analyzed for secreted CCL2. Means ± S.E. of three different experiments are depicted. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA, ***, p < 0.001. D, following TNFα stimulation, anti-TNFR1 treated (TNFα+ab) and non-treated (TNFα) cells were lysed, total RNA extracted and assayed for the abundance of CCL2 mRNA by RT-PCR as described under “Experimental Procedures.” Data represented by arbitrary units normalized to GAPDH. Means ± S.E. of three experiments are depicted. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ***, p < 0.001. E, CCL2 secretion following treatment with TNFR1-blocking antibody. Prior to TNFα treatment, M1+FXYD5 cells were incubated for 1 h with 10 μg/ml TNFR1 blocking antibody or diluent. Medium was removed, and 0.5 ml of fresh medium was added +100 ng/ml TNFα and incubated for 8 h. Medium was removed, and aliquots were analyzed for secreted CCL2. Means ± S.E. of three different experiments are depicted. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ***, p < 0.001.
Article Snippet: Expression and Silencing of FXYD5 in Cultured Cells The
Techniques: Clinical Proteomics, Membrane, Expressing, Labeling, Western Blot, Reverse Transcription Polymerase Chain Reaction, Blocking Assay, Incubation
Journal: The Journal of Biological Chemistry
Article Title: FXYD5 Protein Has a Pro-inflammatory Role in Epithelial Cells
doi: 10.1074/jbc.M115.699041
Figure Lengend Snippet: FXYD5 effect on TNFα receptor is not exclusive to M1 cells. A, TNFα induced CCL2 secretion in H1299. WT and FXYD5 silenced H1299 cells were incubated in the presence or absence of 100 ng/ml TNFα for 24 h. Medium was removed, and aliquots were analyzed for secreted CCL2. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; ****, p < 0.0001. B, time course of TNFα-dependent CCL2 mRNA transcription. 12-well plates of H1299 WT and shFXYD5 cells received 100 ng/ml TNFα for the indicated periods of time. Cells were then lysed, and total RNA was isolated and assayed for the abundance of CCL2 mRNA by RT-PCR. Data are represented by arbitrary units normalized to GAPDH. Means ± S.E. of three experiments are depicted. C, 10-cm plates of M1 and M1+FXYD5 cells were grown till confluence and surface biotinylated proteins were extracted as described under “Experimental Procedures.” Samples were resolved by electrophoresis and blotted with antibodies to TNFR1. The α1 subunit of Na,K-ATPase (α1/NaK) is shown as the loading controls for surface expressed proteins. The figure shows a representative Western blot. D, TNFα induced FXYD5 expression in H1299. 10-cm plates of H1299 WT and shFXYD5 cells received 100 ng/ml TNFα for the indicated periods of time. For total fraction: cells were lysed in RIPA buffer, for surface FXYD5: the cells were biotinylated and extracted in C12E10 buffer (1 mg/ml C12E10, 50 mm Tris, pH 7.5, 1 mm EDTA, 150 mm NaCl). The protein extracts were resolved by Western blotting and assayed for the abundance of FXYD5 with anti FXYD5 (1:100). Specific bands were quantified and normalized to tubulin or α1/NaK expression. A representative Western blot is shown. E, 12-well plates of H1299 WT and shFXYD5 cells received 100 ng/ml TNFα for the indicated periods of time. Cells were lysed and total RNA was isolated and assayed for the abundance of FXYD5 mRNA by RT-PCR. Data are represented by arbitrary units normalized to GAPDH. Data are expressed as means ± S.E. The asterisk indicates a significant difference between the two test groups, as analyzed by ANOVA; *, p ≤ 0.05.
Article Snippet: Expression and Silencing of FXYD5 in Cultured Cells The
Techniques: Incubation, Isolation, Reverse Transcription Polymerase Chain Reaction, Electrophoresis, Western Blot, Expressing
Journal: Human reproduction (Oxford, England)
Article Title: Expression of adiponectin receptors and effects of adiponectin isoforms in mouse preimplantation embryos.
doi: 10.1093/humrep/deq193
Figure Lengend Snippet: Figure 1 Qualitative RT–PCR analysis of adiponectin receptors (AdipoR1, AdipoR2) and adiponectin in oocytes and preimplantation embryos. Agarose gels with separated PCR products are shown. Lanes: Oc, oocytes; 4c, 4-cell embryos; 8c, 8- to16-cell embryos; Mo, morulas; Bl, blastocysts; MW, molecular weight markers; P, posi- tive control tissue (brain for adiponectin receptors, adipose tissue for adiponectin). The sizes of the MW and the predicted sizes of the PCR products in base pairs (bp) are indicated to the right and the left of the panels, respectively.
Article Snippet: Embryo culture and morphological evaluation Four-cell stage embryos were flushed from the oviduct, then pooled, randomly divided into two groups, washed in KSOM culture medium (Specialty Media Group, Phillipsburg, NJ, USA), transferred to KSOM culture drops (1 embryo/1 ml KSOM, covered with mineral oil) containing adiponectin (experimental group) or equivalent amounts of solvent (control group), and cultured in standard conditions (5% CO2 and 378C) for 65 h. Three isoforms of adiponectin were used in the experiments: fulllength adiponectin (mouse Acrp30, recombinant protein, produced in HEK 293 cells, GenWay, San Diego, CA, USA), the truncated isoform—globular adiponectin (mouse Acrp30, globular recombinant protein, produced in Escherichia coli,
Techniques: Reverse Transcription Polymerase Chain Reaction, Molecular Weight, Control
Journal: Human reproduction (Oxford, England)
Article Title: Expression of adiponectin receptors and effects of adiponectin isoforms in mouse preimplantation embryos.
doi: 10.1093/humrep/deq193
Figure Lengend Snippet: Figure 4 Mean cell number in blastocysts after incubation with three different adiponectin isoforms. The 4-cell mouse embryos were incubated in the presence of adiponectin (FL AD, full-length adi- ponectin; GL AD, globular adiponectin; TR AD, trimeric adiponectin) for 65 h, and then the cell number in embryos that reached the blas- tocyst stage was determined. Values are arithmetical means + SEM. Black columns, adiponectin-treated groups; white columns, corre- sponding control groups. Total number of evaluated blastocysts in the experimental groups: FL AD 133, CTRL 160; GL AD 148, CTRL 156; TR AD 141, CTRL 139. Statistical difference between adiponectin-treated groups and corresponding control groups was assessed with unpaired Student’s t-test: **P , 0.01.
Article Snippet: Embryo culture and morphological evaluation Four-cell stage embryos were flushed from the oviduct, then pooled, randomly divided into two groups, washed in KSOM culture medium (Specialty Media Group, Phillipsburg, NJ, USA), transferred to KSOM culture drops (1 embryo/1 ml KSOM, covered with mineral oil) containing adiponectin (experimental group) or equivalent amounts of solvent (control group), and cultured in standard conditions (5% CO2 and 378C) for 65 h. Three isoforms of adiponectin were used in the experiments: fulllength adiponectin (mouse Acrp30, recombinant protein, produced in HEK 293 cells, GenWay, San Diego, CA, USA), the truncated isoform—globular adiponectin (mouse Acrp30, globular recombinant protein, produced in Escherichia coli,
Techniques: Incubation, Control
Journal: Cell
Article Title: Direct Tumor Killing and Immunotherapy through Anti-SerpinB9 Therapy
doi: 10.1016/j.cell.2020.10.045
Figure Lengend Snippet: THE KEY RESOURCES TABLE
Article Snippet: Cell lines and cell culture B16-F10 (mouse melanoma),
Techniques: Recombinant, Modification, Expressing, Plasmid Preparation, RNAscope, Multiplex Assay, Reverse Transcription, Caspase-3 Assay, Drug discovery, Software
Journal: eLife
Article Title: BATF relieves hepatic steatosis by inhibiting PD1 and promoting energy metabolism
doi: 10.7554/eLife.88521
Figure Lengend Snippet:
Article Snippet: Cell line (Human) ,
Techniques: Mouse Assay, Transfection, Construct, Virus, Isolation, Infection, Recombinant, Cell Culture, Retroviral, Transduction, Plasmid Preparation, Luciferase, Activity Assay, Sequencing, Synthesized, Reverse Transcription, Cloning, Reporter Gene Assay, Software, Injection, Control
Journal: Journal of Neuroinflammation
Article Title: Plasminogen activator inhibitor type 1 regulates microglial motility and phagocytic activity
doi: 10.1186/1742-2094-9-149
Figure Lengend Snippet: List of PCR primers used in the study
Article Snippet: The membranes were blocked with 5% skim milk, and sequentially incubated with primary antibodies (rabbit polyclonal anti-mouse PAI-1 antibody, anti-LRP1 antibody (H-80; raised against the N-terminal extracellular domain of 515 kDa LRP1) (both Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit polyclonal anti-STAT1 antibody, rabbit polyclonal anti-phospho-STAT1 antibody (both Cell Signaling Technology, Beverly, MA, USA), monoclonal anti-mouse TLR2 antibody,
Techniques: Reverse Transcription, Real-time Polymerase Chain Reaction
Journal: Journal of Neuroinflammation
Article Title: Plasminogen activator inhibitor type 1 regulates microglial motility and phagocytic activity
doi: 10.1186/1742-2094-9-149
Figure Lengend Snippet: Plasminogen activator inhibitor type 1 (PAI-1) downregulated Toll-like receptor (TLR)2/6 expression and its signaling. (A) BV-2 microglial cells were treated with PAI-1 (100 ng/ml) for 5 hours. TLR2/TLR6 and dectin-1 gene expression was detected by reverse transcriptase PCR. β-actin was used as an internal control. (B) Alternatively, BV-2 microglial cells were treated with PAI-1 (100 ng/ml) for 24 hours. The levels of TLR2, TLR6, and TLR9 protein were then evaluated by western blotting analysis. α-tubulin was used as an internal control. Values indicate the results of densitometric analysis normalized to either β-actin or α-tubulin. (C) Primary microglia cultures were treated with mouse PAI-1 protein (100 ng/ml), lipopolysaccharide (LPS; 100 ng/ml), interferon (IFN)-γ; 50 U/ml), and lipoteichoic acid (LTA; 1 μg/ml) as indicated for 24 hours. (Upper panel) NO production was measured by a Griess reaction. (Lower panel) Cell viability was measured by 2,5-diphenyltetrazolium bromide (MTT) reduction assays, and the results expressed as the percentage of surviving cells over the control cells . Results are given as mean ± SD ( n = 3). * P < 0.01, NS = not significant.
Article Snippet: The membranes were blocked with 5% skim milk, and sequentially incubated with primary antibodies (rabbit polyclonal anti-mouse PAI-1 antibody, anti-LRP1 antibody (H-80; raised against the N-terminal extracellular domain of 515 kDa LRP1) (both Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit polyclonal anti-STAT1 antibody, rabbit polyclonal anti-phospho-STAT1 antibody (both Cell Signaling Technology, Beverly, MA, USA), monoclonal anti-mouse TLR2 antibody,
Techniques: Expressing, Gene Expression, Reverse Transcription, Control, Western Blot